Genetics Plus Unit Test Review Packet tamdistrict org

Genetics Plus Unit Test Review Packet Tamdistrict Org-Free PDF

  • Date:05 Nov 2020
  • Views:10
  • Downloads:0
  • Pages:6
  • Size:447.96 KB

Share Pdf : Genetics Plus Unit Test Review Packet Tamdistrict Org

Download and Preview : Genetics Plus Unit Test Review Packet Tamdistrict Org


Report CopyRight/DMCA Form For : Genetics Plus Unit Test Review Packet Tamdistrict Org


Transcription:

The process of bonding monomers together to form polymers. 5 What is dehydration synthesis How does it relate to hydrolysis. Dehydration synthesis is the bonding of monomers through the loss of water to make a polymer. Hydrolysis is the breaking of bonds between polymers by adding water. 6 What are the major discoveries of the following people. a Chargaff discovered A binds with T and C binds with G. b Watson Crick discovered the overall structure of DNA. c Rosalind Franklin took a xray photo that showed DNA had a helical shape. 7 Draw and label a nucleotide, 8 Draw two nucleotides linking together What is this bond called. 9 Which bases bond together How many hydrogen bonds between them. A binds to T with 2 bonds,C binds to G with 3 bonds. 10 Describe the difference between a purine and pyrimidine Which bases are which. A G are purines which have 2 rings,C T are pyrimidine which have 1 ring. 11 Why does our DNA replicate, So every cells gets a copy of the genetic information. 12 In which direction does DNA replicate,Always 5 prime to 3 prime.
13 What is the first step of DNA Replication Include the name function of the enzyme. Helicase will break hydrogen bonds to unzip and untwist DNA. 14 What is the second step of DNA Replication Include the name function of the enzyme. DNA polymerase copies both strands of DNA from 5prime of the new strand to 3prime but in opposite. directions for each side by reading the original strand and adding the correct complementary nucleotide. 15 What is the third step of DNA Replication Include the name function of the enzyme. Ligase fills in any gaps in the okazaki fragments, 16 Explain how the two sides of DNA replicate differently Use all 3 key terms. One side the leading strand replicates a continuous piece because it replicates as it follows helicase. up the strand of DNA The other side the lagging strand replicates in okazaki fragments because the. DNA polymerase cannot just follow the helicase and must reattach and continue replicating in. 17 What is the outcome of DNA replication, Two new strands of DNA Each has an original strand and a new strand. 18 What are the differences between DNA and RNA, DNA is double stranded has deoxyribose stays in the nucleus has thymine. RNA is single stranded has ribose can leave the nucleus has uracil. 19 What are the three types of RNA Name them draw a picture and explain the function in respects to. transcription translation,mRNA messenger RNA, carries copy of genetic instructions to the rest of the cell. the instructions tell the cell how to assemble the amino acids for making proteins. rRNA ribosomal RNA, makes up a part of ribosomes which are the site for protein synthesis.
tRNA transfer RNA, transfers each amino acid to the ribosome as it is specified by the mRNA. 20 What are the two steps of protein synthesis Where does each take place. Transcription nucleus,Translation cytoplasm, 21 Explain what happens in transcription What enzyme completes this process. RNA polymerase an enzyme binds to DNA and separates the 2 strands. RNA polymerase then uses one strand of DNA as a template for assembling an mRNA. complementary strand, This creates a strand of mRNA which can carry the genetic code out of the nucleus to complete the. second step of protein synthesis, 22 Explain the steps to translation Make sure to include the following key terms mRNA tRNA. rRNA ribosome codon anticodon amino acid peptide bond. 1 mRNA leaves nucleus and enters cytoplasm,2 ribosomes rRNA binds to start.
sequence AUG on mRNA, 3 mRNA is read by ribosome 3 nucleotides at a time called codons. 4 Each codon codes for a specific amino acid, 5 Each codon on mRNA is read and a tRNA with the matching anti codon carries the correct amino. acid to the ribosome, 6 There the tRNA binds to the ribosome and the amino acid is linked to the previous one by a. peptide bond, 7 Process continues amino acids are linked and the polypeptide chain grows until the ribosome. reaches the stop codon, 8 Protein is completed and folds into its structure.
23 What is the point of protein synthesis, To express your genes and help you look function the way you do. 24 What is a codon What is an anticodon How do they relate. A codon is a sequence of 3 nucelotides on mRNA And anticodon is a sequence of 3 nucleotides on. tRNA They are complementary to eachother so that tRNA adds the correct amino acid to the protein. 25 Use the following strand of DNA to complete the rest of the questions. ATGCTACACTGGCTACGAACT,a create the complementary strand of DNA. TACGATGTGACCGATGCTTGA,b create the complementary strand of mRNA. from the strand above,AUGCUACACUGGCUACGAACU,c Use the codon chart below to complete. translation from the above strand of mRNA, met start leu his trp leu arg thr oh no m spender didn t make it a stop codon.
26 What is the end product of mitosis In which cells does it occur. 2 identical cells with a copy of the entire DNA Body cells somatic. 27 What is the end product of meiosis In which cells does it occur. 2 cells with half the genetic information Sex cells gametes. 28 Define the following terms,a Homozygous both alleles the same BB or bb. b Heterozygous both alleles are different Bb, c Dominant the allele trait that will be expressed no matter what the other allele is. d Recessive the allele trait that will only show when both alleles are the recessive. e Genotype your genetic makeup,f Phenotype your physical characteristics. 29 What is incomplete dominance Give an example, Incomplete dominance is when neither allele is dominant to the other The result of the. heterozygote will be a blend of both traits, Example Red flowers RR and white flowers WW make a pink hybrid RW.
30 What is codominance Give an example, In codominance both alleles are dominant and both will be expressed in different cells. Example a black and white cat Human blood type, 31 Long Hair H is dominant over short hair h in cats Cross 2 homozygous cats one with long hair and one. with short hair,h Genotype percents,Phenotype percents. 100 Long hair, 32 In pea plants tall T is dominant over short t Purple flowers P are dominant over white flowers p. Cross a heterozygous purple heterozygous tall pea plant with a heterozygous purple homozygous tall pea. Cross PpTt with PpTT,PT Pt pT pt,PPTT PPTt PpTT PpTt.
PPTT PPTt PpTT PpTt,PpTT PpTt ppTT ppTt,PpTT PpTt ppTT ppTt. Genotype percents,PPTT 2 16 12 5,PpTT 4 16 25,PPTt 2 16 12 5. PpTt 4 16 25,ppTT 2 16 12 5,ppTt 2 16 12 5,Phenotype percents. Purple tall 12 16 75,Purple short 0 16 0,White tall 4 16 25. Genetics Plus Unit Test Review Packet This is NOT everything on the unit test but this is the big idea so far The key to studying is to go over things early and often The more times you see the information over long periods of time the better you will learn it So this will help you start to study for the Unit test and in the long run the final Follow these steps to complete this

Related Books