Communication THE J B C Journal of Biological Chemistry

Communication The J B C Journal Of Biological Chemistry-Free PDF

  • Date:16 Jan 2020
  • Views:48
  • Downloads:0
  • Pages:5
  • Size:364.79 KB

Share Pdf : Communication The J B C Journal Of Biological Chemistry

Download and Preview : Communication The J B C Journal Of Biological Chemistry


Report CopyRight/DMCA Form For : Communication The J B C Journal Of Biological Chemistry


Transcription:

LPS induced Protein tyrosine Kinase Activation 18307. FIG 1 Protein tyrosine kinases mediate endotoxin induction. of IL 1b A THP 1 cells were pretreated with medium M genistein. Downloaded from http www jbc org by guest on January 15 2020. G or vehicle V ethanol and dimethyl sulfoxide each at 0 001 final. concentration and stimulated with endotoxin LPS 1 mg ml as de. scribed under Experimental Procedures Northern blots of total RNA. were hybridized with a nick translated 32P labeled IL 1b cDNA probe. IL 1 tumor necrosis a cDNA probe TNF or junB cDNA probe Jun. B and visualized by autoradiography Northern blots were stripped. and reprobed with a nick translated 32P labeled glyceraldehyde 3. phosphate dehydrogenase cDNA probe GAPDH as a control B THP 1. cells were pretreated with vehicle 1V as described above or genistein. 1G and stimulated with increasing endotoxin concentrations 0 1. ng ml 1 ng ml 10 ng ml 100 ng ml and 1 mg ml as described under. Experimental Procedures Northern blots were hybridized with an. IL 1b cDNA probe IL 1B or glyceraldehyde phosphate dehydrogenase. cDNA probe GAPDH and visualized by autoradiography. for 30 min with 30 mg ml genistein LC Laboratories before addition of. endotoxin 1 mg ml or as indicated in the legends to the figures Esch. erichia coli lipopolysaccharide 0111 B4 Sigma for 1 to 3 h Total RNA. was isolated from 2 3 107 cells condition using RNA STAT 60 TEL. TEST B Inc according to the manufacturer s instructions After trans. fer to nylon membranes IL 1b tumor necrosis factor a junB and. glyceraldehyde 3 phosphate dehydrogenase mRNAs were visualized by. autoradiography as described previously 3, Transfection and Assay for CAT Activity THP 1 cells 1 3 107 cells. transfection were transfected with plasmids containing 6 repeats of the. NFkB consensus binding site of the kappa light chain immunoglobulin. FIG 2 Protein tyrosine kinases mediate the endotoxin induc. enhancer pNH dAN 6XKB gfib CAT kindly provided by Dr E O Neill tion of NFkB activation THP 1 cells were transfected with a CAT. or 3 repeats of the AP 1 consensus binding site of the human collagen reporter gene pNH dAN 6XKB gfib CAT that is dependent only on. ase gene Col TRE 3 3 TK CAT kindly provided by Dr P Angel linked NFkB activation Transfected cells were pretreated with medium ve. to the CAT chloramphenicol acetyltransferase reporter gene using hicle ethanol and dimethyl sulfoxide each at 0 001 final concentra. DEAE dextran as described by Shirakawa and co workers 18 After tion or genistein and stimulated with endotoxin 1LPS as described. 18 20 h cells were pretreated with genistein 30 mg ml and then under Experimental Procedures The results expressed as fold in. stimulated as indicated in the figure legends with endotoxin 1 mg ml crease over 2LPS of a single representative experiment are shown in. or PMA 10 ng ml Sigma for 6 h CAT activity was measured in cell A The averaged result of three separate experiments is shown in B. lysates according to the method of Sleigh 19 where the endotoxin stimulated CAT activity in genistein pretreated. Nuclear Extract Preparation and Assay for DNA Binding of Tran samples are expressed as a percentage of the CAT activity after pre. scription Factors THP 1 cells 2 3 107 cells condition were pretreated treatment with vehicle alone 100 DNA binding of NFkB in nuclear. with genistein 30 mg ml for 30 min before stimulation with endotoxin extracts of THP 1 cells was assessed by electrophoretic mobility shift. 1 mg ml or PMA 10 ng ml for 30 min as indicated in the figures assay and a representative autoradiograph of three separate experi. Nuclear extracts were prepared and assayed for DNA binding of tran ments is shown in C THP 1 cells were pretreated with vehicle ethanol. scription factors as described previously 20 Oligonucleotide probes and dimethyl sulfoxide each at 0 001 final concentration or genistein. and stimulated with endotoxin 1LPS as described under Experimen. used in DNA binding assays were prepared using an Applied Biosys. tal Procedures NFk protein DNA complexes as visualized by autora. tems model 380B automated DNA synthesizer and contained the fol. diography are indicated by the arrow EMSA supershift assays were. lowing sequences a consensus NFkB binding site derived from the performed by including antibodies to NFkB p50 NFkB p65 c Rel and. kappa light chain immunoglobulin enhancer 59 AATTCTCAACAGA various combinations as indicated in D Position of the antibody NFkB. GGGGACTTTCCGAG 39 and the complementary strand a consensus DNA complexes is indicated. AP 1 binding site derived from the human collagenase gene 59 AAT. TCAACGTTGATGAGTCAGCCGGATCCG 39 and the complementary. strand The octamer 1 consensus binding site derived from the immu RESULTS. noglobulin heavy chain enhancer contained 59 AACACCACCTGGGTA. ATTTGCATTTCTAAA 39 and the complementary strand Antibodies Protein tyrosine Kinases Mediate Endotoxin Induction of IL. used in the supershift assays were obtained from Santa Cruz 1b Bacterial endotoxin activates monocytes through mecha. Biotechnology nisms that are incompletely characterized however recent. 18308 LPS induced Protein tyrosine Kinase Activation. studies have implicated PTKs in endotoxin signal transduction. 9 15 Endotoxin is a potent inducer of IL 1b expression in. human monocytes and in the pro monocytic cell line THP 1 To. determine the role of PTKs in the induction of IL 1b expres. sion THP 1 cells were stimulated with endotoxin in the pres. ence of inhibitors of PTKs As shown in Fig 1 preincubation. with the PTK inhibitor genistein inhibited endotoxin stimu. lated IL 1b mRNA accumulation Dose response studies con. firmed the inhibitory effects of genistein at a variety of endo. toxin concentrations Similar results were seen in human blood. monocytes and with another PTK inhibitor herbimycin A data. not shown Endotoxin mediated tumor necrosis factor a. mRNA accumulation is similarly inhibited by preincubation. with genistein In contrast endotoxin stimulated junB mRNA. accumulation is unaffected by preincubation with protein ty. rosine kinase inhibitors These results indicated that PTKs can. specifically mediate endotoxin induction of IL 1b and allowed. us to further investigate the role of PTKs in the activation of. transcription factors by endotoxin in THP 1 cells, Protein tyrosine Kinases Mediate Endotoxin Induction of. NFkB Activation Recent studies have shown that endotoxin. induced NFkB nuclear localization is not dependent on PTK. Downloaded from http www jbc org by guest on January 15 2020. activation 16 We directly tested the transcription compe. tency of NFkB translocated to the nucleus in the absence of. PTK activity Using a CAT reporter gene that is dependent only. on NFkB activation we found that in the absence of PTK. activity endotoxin was unable to activate NFkB dependent. transcription Fig 2 A and B Nuclear localization of NFkB. induced by endotoxin in THP 1 cells was unaffected by the. presence of PTK inhibitors both with respect to DNA binding. Fig 2C and NFkB subunit composition Fig 2D These re. sults suggest that NFkB can be regulated at two separate and. distinct levels nuclear translocation and transcription activa. tion PTKs are apparently involved in the regulation of NFkB. transcription activity, Protein tyrosine Kinases Mediate Endotoxin Induction of. AP 1 Activation We further investigated the specificity of. PTK mediated transcription in response to endotoxin using a. CAT reporter gene that is dependent on the transcription fac. tor AP 1 Treatment of THP 1 cells with PTK inhibitors prior. to endotoxin stimulation did not affect DNA binding or inhibit. CAT expression mediated by AP 1 Endotoxin mediated activa. tion of AP 1 appears to be enhanced in the absence of PTK. activity Fig 3 A and B Furthermore AP 1 transcription. activity in THP 1 cells appears to be negatively regulated by. PTKs as protein kinase C induced AP 1 transcription activity. is also enhanced in the absence of PTK activity Fig 3C DNA FIG 3 Protein tyrosine kinases mediate endotoxin induction. binding by AP 1 is not significantly affected by any of these of AP 1 activation THP 1 cells were transfected with a CAT reporter. treatments Fig 3D These results demonstrate that PTK gene Col TRE 3 3 TK CAT that is dependent only on AP 1 activation. Transfected cells were pretreated with medium vehicle ethanol and. activity is not required for the activation of transcription fac dimethyl sulfoxide each at 0 001 final concentration or genistein. tors by endotoxin and suggest a complex mechanism for acti and stimulated with endotoxin 1LPS as described under Experimen. vation of gene expression in response to endotoxin These stud tal Procedures The results expressed as fold increase over 2LPS of. ies further emphasize a potentially critical role for NFkB in a single representative experiment are shown in A The averaged result. of two separate experiments is shown in B where the endotoxin stim. mediating the expression of inflammatory genes ulated CAT activity in the genistein pretreated sample is expressed as. a percentage of the CAT activity after pretreatment with vehicle alone. DISCUSSION 100 Protein kinase C stimulation of CAT activity in PMA treated. It has been well established that many transcription factors THP 1 cells is shown in C where the averaged result of 2 separate. are modified in response to a variety of stimuli to achieve gene experiments of genistein pretreated samples are expressed as a per. centage of the CAT activity after pretreatment with vehicle alone. activation repression for review see Ref 21 While the pat 100 DNA binding of AP 1 in nuclear extracts of THP 1 cells was. tern of transcription factor modification most commonly pro assessed by electrophoretic mobility shift assay and a representative. tein phosphorylation has been relatively easily elucidated the autoradiograph of three separate experiments is shown in D THP 1. physiologic mechanisms involved in transcription activation cells were pretreated with vehicle ethanol and dimethyl sulfoxide each. at 0 001 final concentration or genistein and stimulated with endo. have only now begun emerging Transcription factor nuclear toxin 1LPS or PMA as described under Experimental Procedures. localization DNA binding and interactions with the basic AP 1 protein DNA complexes as visualized by autoradiography are. transcription machinery as well as with other transcription indicated by the arrow Octamer factor 1 OCT DNA binding was used. factors are all potential regulatory targets in the activation of as a control. gene expression by extracellular signals, LPS induced Protein tyrosine Kinase Activation 18309. Non receptor PTKs 11 and the MAPK ERK family 12 13 not known and many if not all of these molecular targets may. have been implicated in the signal transduction pathway uti respond to endotoxin We have shown that endotoxin mediates. lized by endotoxin Significantly in vitro studies have shown gene expression at least in part through the activation of. that at least one transcription factor ATF 2 is directly phos transcription factors and that the transactivation potential of a. phorylated by the p38 member of the MAPK ERK family in given transcription factor may be determined by protein ty. response to endotoxin 22 Phosphorylation of ATF 2 by p38 rosine kinases activated by endotoxin Whether this response is. was mapped to the amino terminal activation domain at sites altered by endotoxin as a direct result of MAPK ERK activity is. known to increase the transcriptional activity of ATF 2 Sub not clear at this time Tyrosine kinases are not required for. cellular localization of p38 showed cytoplasmic and nuclear endotoxin mediated signaling to the nucleus as is evidenced by. pools establishing a spatial link between this kinase and po endotoxin mediated nuclear translocation of NFkB and en. tential transcription factor targets within the nucleus Specific hanced AP 1 activation in the presence of PTK inhibitors. inhibitors of p38 MAPK ERK have implicated this kinase in the These results suggest a complex mechanism for signal trans. signal transduction pathway to increased expression of inflam duction in the activation of gene expression by endotoxin Our. matory cytokines 23 and recent co transfection studies have finding that NFkB is inactive and that IL 1b and tumor ne. established a direct link between p38 activation and tumor crosis factor a is not expressed in the absence of PTK activity. necrosis factor promoter activation 24 provides further support for a model in which NFkB plays a. In the absence of genetic analyses like gene knock out or critical role in mediating the expression of inflammatory. dominant negative mutants signal transduction pathways mediators. are often dissected through the use of protein kinase inhibitors. Many classes of inhibitors have been utilized in numerous Acknowledgments Oligonucleotide synthesis was performed in the. DNA Synthesis Core Laboratory of the Cancer Center of Wake Forest. studies yet the complex and compensatory nature of intracel University supported in part by National Institutes of Health Grant. lular signaling has made exact mapping of these pathways CA 12197. Downloaded from http www jbc org by guest on January 15 2020. elusive In the studies we have presented the activation of. single transcription factors were used as a measure of intra REFERENCES. for30minwith30mg mlgenistein LCLaboratories beforeadditionof endotoxin 1mg ml orasindicatedinthelegendstothefigures Esch erichiacolilipopolysaccharide0111 B4 Sigma

Related Books