Cellular Molecular TheDEG ENaCProteinMEC

Cellular Molecular Thedeg Enacproteinmec-Free PDF

  • Date:27 Sep 2020
  • Views:2
  • Downloads:0
  • Pages:10
  • Size:1.14 MB

Share Pdf : Cellular Molecular Thedeg Enacproteinmec

Download and Preview : Cellular Molecular Thedeg Enacproteinmec


Report CopyRight/DMCA Form For : Cellular Molecular Thedeg Enacproteinmec


Transcription:

12696 J Neurosci August 31 2011 31 35 12695 12704 A rnado ttir et al Role of MEC 10 in Touch Sensation. activity this finding implies that MEC 10 plays a critical role in fed Escherichia coli expressing double stranded RNA against either. mechanosensation mec 10 or mec 4 Geneservice RNAi library ID number X 4G16. In this paper we resolve the apparent paradox of MEC 10 mec 10 or X 7D15 mec 4 Fraser et al 2000 primer pairs for the. function by showing that the protein is not required for a behav mec 10 clone forward ATCGGAAAACCAACACTTGC and reverse. ioral or electrophysiological response to touch Instead MEC 10 CGTAGTCGCAGTCGATTTCA and for the mec 4 clone forward. TACCTGCAACGGAAAGATCC and reverse ATACAACGGAAA, plays a regulatory role in the channel complex and is essential for. GACGCCAC To control for nonspecific effects of RNAi we compared. full sensitivity to gentle touch In addition we show that five. the touch response of test animals with that of animals fed bacteria ex. previously identified mec 10 mutant alleles are not loss of pressing double stranded RNA against GFP pPD128 110 from the Fire. function mutations but recessive gain of function alleles Finally Lab Vector kit Addgene plasmid 1649 Addgene sequence available at. by recording currents from heterologously expressed channel http www addgene org The bacteria was grown in liquid at 37 C for. complexes we show that the gain of function effect of the mec 10 12 h before seeding onto nematode growth medium isopropyl thio. mutations may be mediated via the MEC 2 accessory subunit d galactoside NGM IPTG plates and then grown at room tempera. ture for 24 h before use Eggs were harvested by bleaching gravid adult. Materials and Methods animals in 0 1 M KOH 10 bleach solution for 5 min The eggs were. Worm strains Wild type N2 and strains with the mutations mec washed three times in M9 buffer and then placed on seeded NGM IPTG. 3 e1338 mec 4 u253 mec 10 e1515 mec 10 u20 mec 10 u390 plates and grown at 20 C lin 35 background or 15 C Punc 119sid 1. mec 10 u332 mec 10 e1715 lin 35 n745 and mec 4 u339 have been Punc 119gfpPmec 6mec 6 lin 15b n744 and Punc 119sid 1Punc 119gfpPmec 6. described previously Brenner 1974 Chalfie and Au 1989 Huang and mec 6 backgrounds Touch assays were as described above and were. Chalfie 1994 Lu and Horvitz 1998 or constructed genetically Brenner performed blind with respect to both the strain and the bacteria on. 1974 In addition we used TU2769 a strain with an integrated array which it was raised. containing mec 17 gfp and lin 15 in a lin 15 n765ts background Whole mount immunochemistry Animals were fixed with 1 formal. O Hagan et al 2005 to generate strains with labeled TRNs mec dehyde for 30 min and permeabilized with mercaptoethanol DTT. 10 ok1104 was obtained from the C elegans Gene Knockout Consor and H2O2 for antibody staining as described Miller and Shakes 1995. tium at Oklahoma Medical Research Foundation Oklahoma City OK Fixed animals were stained with a rabbit polyclonal antibody against the. mec 10 tm1552 was obtained from the National Bioresource Project for N terminus of MEC 2 1 200 Zhang et al 2004 overnight at 4 C and. the Nematode at Tokyo Women s Medical University Tokyo Japan Alexa Fluor 488 conjugated goat anti rabbit antibody 1 2000 Invitro. For visualization of MEC 4 YFP an extrachromosomal array of Pmec 4 gen for 2 h at room temperature Fluorescent micrographs were col. mec 4 yfpPmec 4cfp Chelur et al 2002 was integrated using gamma lected at 100 and used to compute inter punctum intervals as follows. irradiation Mello and Fire 1995 and outcrossed seven times to wild line segments tracing PLM neurons were straightened using the. type before crossing into the mec 10 backgrounds straighten selection function in Fiji http pacific mpi cbg de wiki. mec 10 ok1104 sequencing The following primer pairs were used for index php title Fiji oldid 4701 and straightened segments were. PCR amplification of overlapping 1 2 kb regions of the mec 10 gene for used to compute intensity line scans from which inter punctum intervals. sequencing Genewiz 5 GAAGGAATTTTTTGGGATGGGG and were measured from the distance between intensity peaks. 5 ACGGGTTCAAATTGCAAAGA 5 CACGGATATACAATTGA In vivo electrophysiology Electrical responses to a mechanical stimulus. AGTTTGAC and 5 CACTATCGCCAAAGTATTCCC 5 GATCG were recorded at a holding potential of 74 mV from the cell body of a. GAACTCAAGAAGGAG and 5 CGACACTTGAATGATCCGTG and, PLM touch receptor neuron that was exposed in the tail of an immobi. 5 GTTAGGAACATTTGATACGGTTTC and 5 CAAAAAAAAAATG, lized worm Whole cell recordings and data analysis were performed as. CAAAAGTGTGTACCC cDNA was sequenced from products amplified. described by O Hagan et al 2005 except data were collected using a. from mRNA isolated from ok1104 animals by RT PCR using the follow. HEKA EPC 10 amplifier Recordings with a holding current of less than. ing primer pairs 5 CGTAGTCGCAGTCGATTTCA and 5 CGA, 15 pA and a series resistance of 100 M were used for analysis av. CACTTGAATGATCCGTG and 5 CGTAGTCGCAGTCGATTTCA, erage series resistance was 64 M External saline contained the follow.
and 5 CACTATCGCCAAAGTATTCCC, ing in mM 145 NaCl 5 KCl 5 MgCl2 1 CaCl2 10 KHEPES pH 7 2. Touch assays Animals were assayed for response to gentle touch as. adjusted to 320 mOsm with D glucose Internal saline contained the. described by Chalfie and Sulston 1981 and scored as described by Hob. ert et al 1999 Each animal was usually touched 10 times alternating following in mM 125 Kgluconate 22 NaCl 1 MgCl2 0 6 CaCl2 10. between touch to the anterior and the posterior part of the animal In NaHEPES and 10 K2EGTA pH 7 2 Sulforhodamine 101 20 M was. experiments to test whether mec 10 mutations resulted in differential added to the internal saline to visualize the touch receptor neurite and. responses along the TRN processes we touched individual animals at confirm connection to the cell after recording Holding potential was. specific locations only once All touch assays were performed as blind corrected for liquid junction potentials For current voltage relations. tests the membrane potential at the stimulus site was adjusted for attenuation. To determine the touch sensitivity of animals that had a mec 10 mu because of the distance between the point of stimulus and the recording. tant allele and the mec 10 ok1104 deletion allele we mated mec electrode Vm using the following equation O Hagan et al 2005. 10 ok1104 hermaphrodites with males hemizygous for the mec 10 Vm Vh cosh ln n ds n cosh ln n where Vh is the holding po. mutations and homozygous for the mec 17 gfp transgene from TU2769 tential ln is the length of the neurite n is the length constant and ds is. Animals with this transgene express GFP in the TRNs without any sig the distance between stimulus and electrode The length of the neurite. nificant effect on the touch sensitivity of the animal O Hagan et al was estimated from the length of the body of the worm measured from. 2005 GFP positive F1 progeny were picked from the crosses and tested a video recording using NIH ImageJ http rsbweb nih gov ij using. for response to touch as described above the following relationship O Hagan et al 2005 ln 123 0 34 L. Harsh touch was tested by prodding 20 wild type mec 4 u253 mec where L is the body length in micrometers ds was measured from a. 3 e1338 and mec 10 tm1552 mec 4 u253 animals near the vulva with video recording and n was estimated as described by O Hagan et al. a platinum wire 2005, RNA interference RNA interference RNAi was performed by feeding Pressure dependence of MRCs was calculated as described by O Hagan. essentially as described by Kamath and Ahringer 2003 using three et al 2005 The average P of wild type MRCs we found in these. different RNAi sensitizing backgrounds lin 35 n745 Lehner et al experiments was similar but not identical to the previously published. 2006 Punc 119sid 1Punc 119gfpPmec 6mec 6 lin 15b n744 and Punc 119 value This difference is likely attributable to the errors associated with. sid 1Punc 119gfpPmec 6mec 6 Calixto et al 2010 The latter was used for estimating the spring constants of the reference probe and the stimulus. knockdown of mec 10 in ok1104 animals because mec 10 and lin 15b are probe as well as the area of stimulus probe that contacted the cuticle of. located in close proximity to each other on chromosome X Worms were the animal However this systematic difference had no effect on the. A rnado ttir et al Role of MEC 10 in Touch Sensation J Neurosci August 31 2011 31 35 12695 12704 12697. Amiloride was added from a stock solution 0 1,M in DMSO to a final concentration of 300 M. to the bath solution to record amiloride,insensitive currents. For coimmunoprecipitation experiments,oocytes were injected with cRNAs producing.
myc MEC 4d MEC 2 and wild type or mu,tant forms of MEC 10 GFP An agarose. conjugated polyclonal antibody against c myc,A 14 Santa Cruz Biotechnology was used to. precipitate myc MEC 4d from the lysate fol,lowed by staining of Western blots with an. HRP conjugated monoclonal antibody against,GFP B 2 Santa Cruz Biotechnology to detect. GFP tagged wild type or mutant forms of,Surface expression was tested essentially as.
described Goodman et al 2002 In brief,oocytes were injected with cRNAs for myc. MEC 4d MEC 2 and wild type or mutant,forms of MEC 10 Five days after injection. healthy and intact cells were selected and incu,bated in EZ Link Sulfo NHS LC Biotin Thermo. Scientific Pierce Protein Research Products,Unbound biotin was quenched with free gly. cine and the oocytes were washed several times,before lysis Lysates were incubated with.
agarose conjugated avidin beads to precipitate,biotinylated surface proteins Samples were. then run on SDS PAGE and Western blots,were stained with HRP conjugated c myc an. tibody 9E10 Santa Cruz Biotechnology to,detect surface expressed myc MEC 4d. Figure 1 mec 10 mutant alleles A Touch sensitivity of mec 10 animals Each animal was touched 10 times as described in. Materials and Methods mean SEM n 30 for each B Location of missense mutations in mec 10 mutant alleles within Results. conserved regions of DEG ENaC proteins Protein sequences were aligned using COBALT Papadopoulos and Agarwala 2007 Decreasing or eliminating mec 10. Except ASIC1a Gallus gallus all sequences are from C elegans Gray shading indicates conserved residues at sites mutated in results in a partial defect in touch. mec 10 Residues conserved among all the proteins are highlighted in blue Transmembrane domains are represented by black sensation. boxes C The ok1104 allele carries a 143 bp deletion black bar at the junction of the fourth intron and the fifth exon in the mec 10. Saturation mutagenesis screens for touch, gene Location of primer pairs used for RT PCR amplification is indicated in gray F R1 and R2 D Putative protein products in. insensitive animals identified five mec 10, ok1104 animals as derived from conceptual translation of three different RT PCR products see Results Transmembrane domains.
alleles all recessive with confirmed mu, are represented by black boxes foreign amino acid residues by red bars and a deletion by a white bar. tations e1515 u20 u390 u332 and e1715,Chalfie and Sulston 1981 Chalfie and. interpretation of results as differences in P values between wild type. Au 1989 On average mec 10 mutant an, and mutants were highly consistent imals respond only to 1 4 touches of 10 whereas wild type ani. Single channel conductance of the mechanoreceptor channel in wild mals respond to 9 touches of 10 Fig 1 A Each of the mec 10. type and mec 10 deletion animals was determined using nonstationary alleles has a single missense mutation Huang and Chalfie 1994. noise analysis Heinemann and Conti 1992 as described by O Hagan et that affects a protein domain that is conserved within the DEG. al 2005 ENaC protein family Fig 1 B Therefore these mutations may. Heterologous expression electrophysiology coimmunoprecipitation and affect critical functions not only of MEC 10 but also of DEG. detection of surface expressed channels Expression constructs for ENaC channel proteins more generally. MEC 4d A713T MEC 2 MEC 6 MEC 10 myc MEC 4d A713T, To determine whether loss of mec 10 also results in a touch. and MEC 10 GFP have all been described previously Chelur et al 2002. Goodman et al 2002 Point mutations corresponding to mec 10 muta insensitive phenotype we characterized a candidate null allele. tions were generated using the QuikChange site directed mutagenesis kit mec 10 ok1104 The ok1104 allele was identified by PCR based. Stratagene screening of a deletion library rather than a phenotype based. cRNA was synthesized using the T7 mMESSAGE mMACHINE kit screen ok1104 animals had a partial defect in response to gentle. Applied Biosystems Ambion Ten nanograms of MEC 4d MEC 2 touch a phenotype that was weaker than any of the five previ. MEC 10 and 1 ng of MEC 6 cRNA were injected into Xenopus laevis ously identified mec 10 alleles Fig 1 A. oocytes Oocytes were cultured in ND 96 with penicillin streptomycin ok1104 animals have a 143 bp deletion in the mec 10 gene. and 300 M amiloride at 17 C and recorded from or used for biochemical starting at the junction between the fourth intron and the fifth. experiments 5 d after injection Two electrode voltage clamp record. exon To learn how this deletion affects MEC 10 expression we. ings coimmunoprecipitation and surface expression experiments were. performed as described previously Chelur et al 2002 Goodman et al. d galactoside NGM IPTG plates and then grown at room tempera ture for 24 h before use Eggs were harvested by bleaching gravid adult animals in 0 1 M KOH 10 bleach solution for 5 min The eggs were washed three times in M9 buffer and then placed on seeded NGM IPTG plates and grown at 20 C lin 35 background or 15 C P unc 119 sid 1

Related Books